Pages

.

A Bioinformatics Bookmarklet

Sometimes you want to scrape some screen data and analyze it on the spot without copying it to another program. It turns out there's an easy way to do just that. Just highlight the information (by click-dragging the mouse to Select a section of screen data), then run a piece of JavaScript against the selection.

Example: I do a lot of peeking and poking at DNA sequences on the web. Often, I'm interested in knowing various summary statistics for the DNA I'm looking at. For example, I might see a long sequence that looks like AGTTAGAAAACCTCAGCTACTAG (etc.) and wonder what the G+C content of that stream is. So I'll select the text by click-dragging across it. Then I'll obtain the text in JavaScript by calling getSelection().toString(). Then I parse the text and display the results in an alert dialog.

Suppose I've selected a run of DNA on-screen and I want to know the base content (the amounts of G, C, T, and A).


text = getSelection().toString(); // get the data as a string
text = text.toUpperCase(); // optionally convert it to upper case

bases = new Object;  // create a place to store the base counts
bases.G = bases.C = bases.T = bases.A = 0; // initialize

// now loop over the string contents:
for (var i = 0; i < text.length; i++)
bases[ text[i] ]++; // bump the count for that base
 
// format the data for viewing
msg = "G: " + bases.G/text.length + "\n";
msg += "C: " + bases.C/text.length + "\n";
msg += "A: " + bases.A/text.length + "\n";
msg += "T: " + bases.T/text.length + "\n";
msg += "GC Content: " + (bases.G + bases.C)/text.length; 
 
// view it:
alert( msg ); 
 
If I run this script against a web page where I've highlighted some DNA text, I get:



The nice part is, you can put the above code in a bookmarklet, associate the bookmarklet with a button, and keep it in your bookmark bar so that whenever you want to run the code, you can just point and click. To do the packaging, reformat the above code (or your modified version of it) as a single line of code preceded by "javascript:" (don't forget the colon), then set that code as the URL of a bookmark. Instead of going to a regular URL, the browser will see "javascript:" as the URL scheme and execute the code directly.

Bookmarklets of this sort have proven to be a major productivity boon for me in various situations as I cruise the web. When I see data I want to analyze, I don't have to copy and paste it to Excel (or whatever). With a bookmarklet, I can analyze it instantly, sur la vitre.



reade more... Résuméabuiyad

What does it mean to have "predicted the crisis"?




Since 2008, quite a lot of people have boldly claimed that they "predicted the crisis". Usually, the claimants use this "fact" to argue for the superiority of their economic school of thought, modeling approach, investing approach, or personal intuition. But what does it mean to have "predicted the crisis"?

First of all, there are different things that get labeled "the crisis". These include:

1. The big drop in U.S. housing prices that started in 2006-7.

2. The systemic collapse of the U.S. financial industry that began in 2008.

3. The deep recession and the long stagnation that began in late 2008.

Predicting one of these is not the same as predicting the others. It is possible, for example, to have missed the housing bubble and the finance industry collapse, but to have successfully predicted, after seeing these events happen, that a deep recession and long stagnation would be the result; this is what Marco Del Negro et al. claim to have done, and a number of pundits and commentators made informal recession predictions after housing peaked in 2006. Alternatively, it is possible to have predicted the bursting of the housing bubble without foreseeing the systemic damage that this would cause to the financial system; some economists, such as Dean Baker and Nouriel Roubini (and of course, Robert Shiller), seem to have called the bubble far in advance, as well as some writers like Bill McBride. It is also possible to have predicted the collapse of the big banks and their mortgage-backed bonds - and made money off of this - while staying agnostic about the macroeconomic consequences; this seems to have made a lot of money for investors like Steve Eisman and John Paulson. Of course, in theory it might have been possible to predict all three events.

Then there's the question of what it means to "predict" something. Here are some alternative definitions:

1. You could predict the timing of an event, e.g. when the housing bubble would burst.

2. You could predict the size or severity of an event, e.g. how much house prices would decline or how much the economy would contract in 2009.

3. You could predict the duration of an event, e.g. how long our economy would stagnate after the recession, or how long it would be before housing prices reached their pre-crash peak.

4. You could describe the particular characteristics of an event, e.g. what would cause banks to fail, or whether they would be bailed out, or whether inflation would remain subdued after the recession.

Next, there is the question of with what degree of confidence you make a prediction. Saying "this event is a conceivable possibility" is different than saying "the risk of this event is high," which is different from saying "the risk of this event has increased," which is different from saying "this event will happen."

Also, there is the question of how far in advance a prediction was made. That could be important.

Finally, there is the question of whether the prediction was made by a model or by a human. If it's a model, then there's the hope that humanity has a tool with which to predict future crisis events.

Anyway, how should we evaluate these claims? There are so many different combination of "predictions" and "crises" here that it's very difficult to lay out an explicit taxonomy of who got it "more right," and who got it "less right." As a more humble goal, we can examine a specific individual or model, and identify which events he/she/it predicted, with what degree of confidence, and when.

As an example, let's take Steve Keen.



Steve Keen, formerly a professor at the University of Western Sydney, is known for claiming more loudly and confidently than just about anyone else on the planet that he "predicted the global financial crisis". According to Keen, this should be a reason to believe his extensive critiques of neoclassical (i.e. mainstream) economics, and his suggested alternative paradigm, known as "Post-Keynesianism".

So in what way did Keen "predict the crisis"?

Searching the internet, I can find no record of an ex-ante prediction by Keen of a large-scale U.S. housing bubble. He did, however, predict an Australian housing bubble, in 2007 after the U.S. housing bubble had already begun to pop. That prediction has so far yet to materialize; Australian housing prices have not collapsed yet. As a result of this incorrect prediction, Keen lost a high-profile bet.

Did Keen predict the collapse of the U.S. finance industry (the Lehman shock and subsequent bailouts)? Not that I can find. Nor did he warn of the risk of such an industry collapse, as far as I can find.

How about the recession and stagnation? Here, Keen makes his strongest claim to have made an ex ante prediction. His argument is laid out in this paper. (Warning: as others have noted, Keen's papers are nearly unreadable.)

Much of the paper covers the history of macroeconomics as Keen sees it. Later, on page 10, we get to the part where he explains how he "predicted the crisis". Keen presents a macroeconomic model; actually, a class of macroeconomic models. Each of the models is a system of deterministic Ordinary Differential Equations describing the behavior of macroeconomic aggregates. He claims that this sort of model would allow one to realize that a crisis of the type we observed could potentially occur.

Notice, therefore, that this is not a prediction of timing. It is a prediction of the particular characteristics of a recession. And as to whether or not it is intended to be a prediction of the severity or duration of the recession...that's not clear. Keen isn't saying when a recession would happen, he's saying that his model shows what it would look like.

And what would it look like? Well, one of the models Keen presents (a "Goodwin" model, apparently from the 1960s) produces cycles of employment and output that look like this:


As you can see, these cycles are periodic, and of constant amplitude. But we know that this is not what business cycles really look like. (More complicated versions of this type of model might veer from periodicity into extreme nonlinearity and chaos, but chaotic models by definition have little to no predictive power.)

The next model he references is one of his own, produced in 1995. That model contains the possibility of something like a complete economic collapse:
My own simulations in Keen (1995) illustrated this possibility of a debt-induced collapse if the rate of interest was too high. For a low rate, a convergence to equilibrium occurred (Figure 4): 


At a higher rate, the system approached the infinite debt to output ratio equilibrium...

However, we have not observed an approach toward the infinite-debt-to-output ratio and near-total unemployment equilibrium that . Also, interest rates were still historically low when the financial crisis began. So this 1995 Keen model does not appear to describe the crisis we really had. Keen also adds:
[T]he 1995 model lacked price dynamics.
It's also noteworthy that Keen's 1995 model, like the "Goodwin model", contains plenty of periodicity, which as I mentioned is not observed in real life.

Keen then goes on to present a model that does include price dynamics. The figures he presents from that model is labeled "Schandl (2011)", indicating that it was made after the crisis and cannot therefore cannot be regarded as a prediction. Note that in that model, as presented by Keen, the economic collapse takes 40+ years to happen, and involves unemployment going to 100%:


In any case, it is clearly apparent that nowhere in this paper - or in any other paper that I can find - does Keen present a model whose output bears even a passing resemblance to the crisis we experienced in the late 2000s. (As an aside, note that many models, including a simple neoclassical Ramsey model, have equilibria in which the economy collapses completely. Building such a model is very very easy. But complete economic collapses - total and permanent cessations of economic activity - haven't yet been seen in the real world...ever.)

Therefore, we can conclude that there is no Steve Keen model that predicted the recession and long stagnation that we've experienced. And in fact, there does not seem to be any "Post-Keynesian model" whose features closely resemble the financial crises and recessions that we see in the real world.

So did Steve Keen himself warn in the early or mid 2000s of the impending possibility of an economic collapse? He claims that he did warn of an "impending global recession" in 2005 (see also here). I cannot find any actual writings by Keen from 2005, but I will take him at his word, since if he had made this up, I'm sure that his fellow Aussies would quickly tar and feather him for it. (If you have links to the 2005 prediction, please post them in the comments section.)

So Steve Keen presumably did warn in 2005 that a global recession was coming. This means that, counting his prediction of an imminent Australian crash, he has a 50% success rate. Remember that, according to Bayes' Theorem, the predictions of someone with an unconditional 50% success rate (i.e., coin flips) convey no information.

But is that his true success rate? After all, how many earlier predictions of imminent global recession has Keen made, that did not materialize? According to this website, Keen was predicting an imminent global recession as early as 1995. It was 12 or 13 years before his prediction came true; this long time lag makes the prediction a bit less impressive, since someone who in 1933 predicted a global recession - which did come, 80 years later - would nevertheless now be seen as having been "wrong". Now, 12 years is better than 80 years, of course.

Anyway, so we see that Steve Keen's prediction of the global financial crisis was considerably less impressive than his bold claims would have us believe. He does not have a model that can predict bubbles, financial collapses, or recessions. His personal warnings of doom often don't seem to materialize for over a decade...if they materialize at all. If you trust Steve Keen as an economist or as a personal prognosticator based on his 2005 warnings of imminent global recession, you may be falling victim to the common behavioral phenomenon of overconfidence. (Not that I expect this fact to give pause to many of his...um...ardent followers. Remember that pundits get more fans by displaying self-confidence than by being right!)

Of course, all this is not to say that Keen should receive zero plaudits, respect, or commendation for his 2005 warning - or, for that matter, for his 1995 and 2007 warnings. There are plenty of people out there who said that finance has nothing to do with recessions. There are plenty of people out there - including some very prominent mainstream economists - who said that big recessions couldn't happen anymore. However right Keen did or didn't get it - and even if he made his predictions just by reading old Minsky books and nodding his head in vague agreement - those mainstream people got things far less right.

Anyway, a similar exercise can be applied to any other economist, model, or pundit whom you think may have "predicted the crisis". You will obtain varying results, though my bet is that few will be as spectacular as you might hope.

In conclusion: Predictions are hard, especially about the future. Sometimes people get things right because they understand how the world works, and sometimes they get things right by luck. The idea of a brilliant Cassandra-like sage, shouting in the wilderness while everyone ignores his or her trenchant warnings, is occasionally true, but not as much as we would like to think.


(Update: Naturally, a bunch of people have been asking me: "So, Noah, blah blah blah, but who do you think predicted the crisis the best?" Well, I don't know. Back in 2002 and 2003 I was reading Dean Baker talking about a housing bubble and bank failures. And I remember believing that, and as a result not being too surprised when the crisis came. I'm fairly sure Baker also predicted that the macroeconomic knock-on effects would be severe. Nor do I recall him predicting a bunch of other crises that never happened. So from my very limited set of knowledge, I'd guess that Baker did very well as a prognosticator. But to really know, I'd have to go back and check systematically. Note also that Dean is a quite humble guy and doesn't go around thumping his chest about having "called the crisis"...)
reade more... Résuméabuiyad

DSGE + financial frictions = macro that works?

File:Mitrailleuse front.jpg

In my last post, I wrote:
So far, we don't seem to have gotten a heck of a lot of a return from the massive amount of intellectual capital that we have invested in making, exploring, and applying [DSGE] models. In principle, though, there's no reason why they can't be useful.
One of the areas I cited was forecasting. In addition to the studies I cited by Refet Gurkaynak, many people have criticized macro models for missing the big recession of 2008Q4-2009. For example, in this blog post, Volker Wieland and Maik Wolters demonstrate how DSGE models failed to forecast the big recession, even after the financial crisis itself had happened:


This would seem to be a problem. 

But it's worth it to note that, since the 2008 crisis, the macro profession does not seem to have dropped DSGE like a dirty dishrag. Instead, what most business cycle theorists seem to have done is simply to add financial frictions to the models. Which, after all, kind of makes sense; a financial crisis seems to have caused the big recession, and financial crises were the big obvious thing that was missing from the most popular New Keynesian DSGE models.

So, there are a lot of smart macroeconomists out there. Why are they not abandoning DSGE? Many "sociological" explanations are possible, of course - herd behavior, sunk cost fallacy, hysteresis and heterogeneous human capital (i.e. DSGE may be all they know how to do), and so on. But there's also another possibility, which is that maybe DSGE models, augmented by financial frictions, really do have promise as a technology.

This is the position taken by Marco Del Negro, Marc P. Giannoni, and Frank Schorfheide of the New York Fed. In a 2013 working paper, they demonstrate that a certain DSGE model was able to forecast the big post-crisis recession.

The model they use is a combination of two existing models: 1) the famous and popular Smets-Wouters (2007) New Keynesian model that I discussed in my last post, and 2) the "financial accelerator" model of Bernanke, Gertler, and Gilchrist (1999). They find that this hybrid financial New Keynesian model is able to predict the recession pretty well as of 2008Q3! Check out these graphs (red lines are 2008Q3 forecasts, dotted black lines are real events):



I don't know about you, but to me that looks pretty darn good!

I don't want to downplay or pooh-pooh this result. I want to see this checked carefully, of course, with some tables that quantify the model's forecasting performance, including its long-term forecasting performance. I will need more convincing, as will the macroeconomics profession and the world at large. And forecasting is, of course, not the only purpose of macro models. But this does look really good, and I think it supports my statement that "in principle, there is no reason why [DSGEs] can't be useful."

Remember, sometimes technologies take a long time to mature. People thought machine guns were a joke after they failed to help the French in the War of 1870. But after World War 1, nobody was laughing anymore.

However, I do have an observation to make. The Bernanke et al. (1999) financial-accelerator model has been around for quite a while. It was certainly around well before the 2008 crisis. And we had certainly had financial crises before, as had many other countries. Why was the Bernanke model not widely used to warn of the economic dangers of a financial crisis? Why was it not universally used for forecasting? Why are we only looking carefully at financial frictions after they blew a giant gaping hole in the world economy?

It seems to me that it must have to do with the scientific culture of macroeconomics. If macro as a whole had demanded good quantitative results from its models, then people would not have been satisfied with the pre-crisis finance-less New Keynesian models, or with the RBC models before them. They would have said "This approach might work, but it's not working yet, let's keep changing things to see what does work." Of course, some people said this, but apparently not enough. 

Instead, my guess is that many people in the macro field were probably content to use DSGE models for storytelling purposes, and had little hope that the models could ever really forecast the actual economy. With low expectations, people didn't push to improve the existing models as hard as they might have. But that is just my guess; I wasn't really around.

So to people who want to throw DSGE in the dustbin of history, I say: You might want to rethink that. But to people who view the del Negro paper as a vindication of modern macro theory, I say: Why didn't we do this back in 2007? And are we condemned to "always fight the last war"?


Update: Mark Thoma has some very good thoughts on why we didn't use this sort of model pre-2008, even though we had the chance.

Update 2: Some commenters and Twitter people have been suggesting that the authors tweaked ("calibrated") the parameters of the model in order to produce the impressive results seen above. The authors say in the paper (p. 13, section 3.1) that they did not do this; rather, they estimated the model using only data before 2008Q3. 

Which is good, because calibrating parameters to produce better forecasts is definitely something you are not supposed to do!! There is a difference between "fitting" and "pseudo-out-of-sample forecasting". The red lines seen in the picture above are labeled "forecasts". To do a "pseudo-out-of-sample forecast", you train (fit) the model using only data before 2008Q3, and then you produce a forecast and compare it with the post-2008Q3 data to see how good your forecast was. You should never fiddle with the model parameters to make the "forecast" come out better! 

From Section 3.1 of the paper it seems fairly clear that del Negro et al. did not make this mistake. But I think the authors should explain the forecasting procedure itself in greater detail in the next iteration of the working paper...just in case readers worry about this.
reade more... Résuméabuiyad

A Very Simple Test of Chargaff's Second Rule

We know that for double-stranded DNA, the number of purines (A, G) will always equal the number of pyrimidines (T, C), because complementarity depends on A:T and G:C pairings. But do purines have to equal pyrimidines in single-stranded DNA? Chargaff's second parity rule says yes. Simple observation says no.

Suppose you have a couple thousand single-stranded DNA samples. All you have to do to see if Chargaff's second rule is correct is create a graph of A versus T, where each point represents the A and T (adenine and thymine) amounts in a particular DNA sample. If A = T (as predicted by Chargaff), the graph should look like a straight line with a slope of 1:1.

For fun, I grabbed the sequenced DNA genome of Clostridium botulinum A strain ATCC 19397 (available from the FASTA link on this page; be ready for a several-megabyte text dump), which contains coding sequences for 3552 genes of average length 442 bases each, and for each gene, I plotted the A content versus the T content.

A plot of thymine (T) versus adenine (A) content for all 3552 genes in C. botulinum coding regions. The greyed area represents areas where T/A > 1. Most genes fall in the white area where A/T > 1.

As you can see, the resulting cloud of points not only doesn't form a straight line of slope 1:1, it doesn't even cluster on the 45-degree line at all. The center of the cluster is well below the 45-degree line, and (this is the amazing part) the major axis of the cluster is almost at 90 degrees to the 45-degree line, indicating that the quantity A+T tends to be conserved.

A similar plot of G versus C (below) shows a somewhat different scatter pattern, but again notice that the centroid of the cluster is well off the 45-degree centerline. This means Chargaff's second rule doesn't hold (except for the few genes that randomly fell on the centerline).

A plot of cytosine (C) versus guanine (G) for all genes in all coding regions of C. botulinum. Again, notice that the points cluster well away from the 45-degree line (where they would have been expected to cluster, according to Chargaff).

The numbers of bases of each type in the botulinum genome are:
G: 577108
C: 358170
T: 977095
A: 1274032

Amazingly, there are 296,937 more adenines than thymines in the genome (here, I'm somewhat sloppily equating "genome" with combined coding regions). Likewise, excess guanines number 218,938. On average, each gene contains 73 excess purines (42 adenine and 31 guanine).

The above graphs are in no way unique to C. botulinum. If you do similar plots for other organisms, you'll see similar results, with excess purines being most numerous in organisms that have low G+C content. As explained in my earlier posts on this subject, the purine/pyrimidine ratio (for coding regions) tends to be high in low-GC organisms and low in high-GC organisms, a relationship that holds across all bacterial and eukaryotic domains.
reade more... Résuméabuiyad

Chargaff's Second Parity Rule is Broadly Violated

Erwin Chargaff, working with sea-urchin sperm in the 1950s, observed that within double-stranded DNA, the amount of adenine equals the amount of thymine (A = T) and guanine equals cytosine (G = C), which we now know is the basis of "complementarity" in DNA. But Chargaff later went on to observe the same thing in studies of single-stranded DNA, causing him to postulate that A = T and G = C more generally (within as well as across strands of DNA). The more general postulation is known as Chargaff's second parity rule. It says that A = T and G = C within a single strand of DNA.

The second parity rule seemed to make sense, because there was and is no a priori reason to think that DNA or RNA, whether single-stranded or double-stranded, should contain more purines than pyrimidines (nor vice versa). All other factors being equal, nature should not "favor" one class of nucleotide over another. Therefore, across evolutionary times frames, one would expect purine and pyrimidine prevalences in nucleic acids to equalize.

What we instead find, if we look at real-world DNA and RNA, is that individual strands seldom contain equal amounts of purines and pyrimidines. Szybalski was the first to note that viruses (which usually contain single-stranded nucleic acids) often contain more purines than pyrimidines. Others have since verified what Szybalski found, namely that in many organisms, DNA is purine-heavy on the "sense" strand of coding regions, such that messenger RNA ends up richer in purines than pyrimidines. This is called Szybalski's rule.

In a previous post, I presented evidence (from analysis of the sequenced genomes of 93 bacterial genera) that Szybalski's rule not only is more often true than Chargaff's second parity rule, but in fact purine-loading of coding region "message" strands occurs in direct proportion to the amount of A+T (or in inverse propoertion to the amount of G+C) in the genome. At G+C contents below about 68%, DNA becomes heavier and heavier with purines on the message strand. At G+C contents above 68%, we find organisms in which the message strand is actually pyrimidine-heavy instead of purine-heavy.

I now present evidence that purine loading of message strands in proportion to A+T content is a universal phenomenon, applying to a wide variety of eukaryotic ("higher") life forms as well as bacteria.

According to Chargaff's second parity rule, all points on this graph should fall on a horizontal line at y = 1. Instead, we see that Chargaff's rule is violated for all but a statistically insignificant subset of organisms. Pink/orange points represent eukaryotic species. Dark green data points represent bacterial genera. See text for discussion. Permission to reproduce this graph (with attribution) is granted.

To create the accompanying graph, I did frequency analysis of codons for 58 eukaryotic life forms (pink data points) and 93 prokaryotes (dark green data points) in order to derive prevalences of the four bases (A, G, C, T) in coding regions of DNA. Eukaryotes that were studied included yeast, molds, protists, warm and cold-blooded animals, flowering and non-flowering plants, alga, and insects and crustaceans. The complete list of organisms is shown in a table further below.

It can now be stated definitively that Chargaff's second parity rule is, in general, violated across all major forms of life. Not only that, it is violated in a regular fashion, such that purine loading of mRNA increases with genome A+T content. Significantly, some organisms with very low A+T content (high G+C content) actually have pyrimidine-loaded mRNA, but they are in a small minority.

Purine loading is both common and extreme. For about 20% of organisms, the purine-pyrimidine ratio is above 1.2. For some organisms, the purine excess is more than 40%, which is striking indeed.

Why should purines migrate to one strand of DNA while pyrimidines line up on the other strand? One possibility is that it minimizes spontaneous self-annealing of separated strands into secondary structures. Unrestrained "kissing" of intrastrand regions during transcription might lead to deleterious excisions, inversions, or other events. Poly-purine runs would allow the formation of many loops but few stems; in general, secondary structures would be rare.

The significance of purine loading remains to be elucidated. But in the meantime, there can be no doubt that purine enrichment of message strands is indeed widespread and strongly correlates to genome A+T content. Chargaff's second parity rule is invalid, except in a trivial minority of cases.

The prokaryotic organisms used in this study were presented in a table previously. The eukaryotic organisms are shown in the following table:

Organism Comment G+C% Purine ratio
Chlorella variabilis strain NC64A endosymbiont of Paramecium 68.76 1.1055181128896376
Chlamydomonas reinhardtii strain CC-503 cw92 mt+ unicellular alga 67.96 1.0818749999999997
Micromonas pusilla strain CCMP1545 unicellular alga 67.41 1.1873268193087356
Ectocarpus siliculosus strain Ec 32 alga 62.74 1.2090728330510347
Sporisorium reilianum SRZ2 smut fungus 62.5 0.9776547360094916
Leishmania major strain Friedlin protozoan 62.47 1.0325
Oryza sativa Japonica Group rice 54.77 1.0668412348401317
Takifugu rubripes (torafugu) fish 54.08 1.0655094027691674
Aspergillus fumigatus strain A1163 fungus 53.89 1.013091641490433
Sus scrofa (pig) pig 53.77 1.0680595779892428
Drosophila melanogaster (fruit fly)
53.69 1.0986989367655287
Brachypodium distachyon line Bd21 grass 53.32 1.0764746703677999
Selaginella moellendorffii (Spikemoss) moss 52.83 1.1014492753623195
Equus caballus (horse) horse 52.29 1.0844453711426192
Pongo abelii (Sumatran orangutan) orangutan 52 1.0929015146227405
Homo sapiens human 51.97 1.0939049081896255
Mus musculus (house mouse) strain mixed mouse 51.91 1.0827720297201582
Tuber melanosporum (Perigord truffle) strain Mel28 truffle 51.4 1.0836820083682006
Phaeodactylum tricornutum strain CCAP 1055/1 diatom 51.06 1.0418452745458253
Arthroderma benhamiae strain CBS 112371 fungus 50.99 1.0360268674944024
Ornithorhynchus anatinus (platypus) platypus 50.97 1.1121909993661525
Taeniopygia guttata (Zebra finch) bird 50.81 1.1344717182497328
Trypanosoma brucei TREU927 sleeping sickness protozoan 50.78 1.106974784013486
Danio rerio (zebrafish) strain Tuebingen fish 49.68 1.1195053003533566
Gallus gallus chicken 49.54 1.1265418970650787
Monodelphis domestica (gray short-tailed opossum) opossum 49.07 1.0768110918544194
Sorghum bicolor (sorghum) sorghum 48.93 1.046422719825232
Thalassiosira pseudonana strain CCMP1335 diatom 47.91 1.1403183213189638
Hyaloperonospora arabidopsis mildew 47.75 1.053039546400631
Daphnia pulex (common water flea) water flea 47.57 1.058036633052068
Physcomitrella patens subsp. patens moss 47.33 1.1727134477514667
Anolis carolinensis (green anole) lizard 46.72 1.113765477057538
Brassica rapa flowering plant 46.29 1.1056659411640803
Fragaria vesca (woodland strawberry) strawberry 46.02 1.1052853232259425
Amborella trichopoda flowering shrub 45.88 1.0992441209406494
Citrullus lanatus var. lanatus (watermelon) watermelon 44.5 1.0855134984692458
Capsella rubella mustard-family plant 44.37 1.1041257367387034
Arabidopsis thaliana (thale cress) cress 44.15 1.109853013573388
Lotus Japonicus lotus 44.11 1.0773228019122847
Populus trichocarpa (Populus balsamifera subsp. trichocarpa) tree 43.7 1.1097672456226706
Cucumis sativus (cucumber) cucumber 43.56 1.0823847862298719
Caenorhabditis elegans strain Bristol N2 worm 42.96 1.106320224719101
Vitis vinifera (grape) grape 42.75 1.0859833393697935
Ciona intestinalis tunicate 42.68 1.158652461848546
Solanum lycopersicum (tomato) tomato 41.7 1.1177
Theobroma cacao (chocolate) chocolate 41.31 1.1297481860862142
Medicago truncatula (barrel medic) strain A17 flowering plant 40.78 1.093754366354618
Apis mellifera (honey bee) strain DH4 honey bee 39.76 1.216042543762464
Saccharomyces cerevisiae (bakers yeast) strain S288C yeast 39.63 1.1387641650630744
Acyrthosiphon pisum (pea aphid) strain LSR1 aphid 39.35 1.1651853457619772
Debaryomyces hansenii strain CBS767 yeast 37.32  1.1477345930856775
Pediculus humanus corporis (human body louse) strain USDA louse 36.57 1.2365791828213537
Schistosoma mansoni strain Puerto Rico trematode 35.94 1.0586902800658977
Candida albicans strain WO-1 yeast 35.03 1.1490291609944834
Tetrapisispora phaffii CBS 4417 strain type CBS 4417 yeast 34.69 1.17503805175038
Paramecium tetraurelia strain d4-2 protist 30.03 1.2494922903347117
nucleomorph Guillardia theta endosymbiont 23.87 1.1529462427330803
Plasmodium falciparum 3D7 malaria parasite 23.76 1.4471365638766511
reade more... Résuméabuiyad

What can you do with a DSGE model?



When the Bank of England invited me to give a talk at their workshop on macroeconomics, I wasn't sure if they wanted me to provoke (i.e. troll) them with the kind of skeptical stuff I usually write on this blog, or to talk about my own research on artificial markets and expectations. So I did both. Now, this is a central bank event, which means secrecy prevails - so I can't tell you what the reaction was to my talk, or what other people said in theirs. But I thought I'd reproduce part of my talk in a blog post - the part where I talked about DSGE models. (In other words, the provocative part.)

"DSGE" is a loose term. It usually implies much more than dynamics, stochastics, and general equilibrium; colloquially, to be "DSGE" your model probably has to have things like infinitely far-sighted rational expectations, rapid clearing of goods markets, certain simple types of agent aggregation, etc. So when I talk about "DSGE models", I'm loosely referring to ones whose form is based on the 1982 Kydland & Prescott "RBC" model.

In recent times, of course, RBC models themselves have fallen out of favor somewhat in the mainstream business-cycle-modeling community, and have gone on to colonize other fields like asset pricing, international finance, and labor econ. As of 2013, the most "mainstream" DSGE models of the business cycle are "New Keynesian" models. The most important of these is the Smets-Wouters model, which has gained a huge amount of attention, especially from central banks, for seeming to be able to forecast the macroeconomy better than certain popular alternative approaches. If you know only one DSGE model, Smets-Wouters is the one you should know.

Anyway, my talk asked the question: "What can you do with a DSGE model?" Most people who evaluate the DSGE paradigm don't focus on this question; they either trace the historical reasons for the adoption of DSGE (the Lucas Critique, etc.), or they discuss the ways DSGE models might be improved. Instead, in my talk, I wanted to take the perspective of an alien econ prof who showed up on Earth in 2013 and tried to evaluate what human macroeconomic theorists were doing.

A DSGE model is just a tool. It's a gizmo, like a fork lift or a lithium-ion battery. The U.S. and Europe have invested an enormous amount of intellectual capital - thousands of person-years of our best and brightest minds - in creating, testing, and using these tools.

So what can you do with these tools?


1. Forecast the economy?

One thing you might want to do with a business cycle model is to forecast the business cycle. DSGE models have improved enormously in this regard. Though early RBC models were notoriously bad at forecasting, more recent, complex DSGE models have proven much better, and are now considered slightly better than vector autoregressions, and about as good as the Fed's own forecasts.

But as Rochelle Edge and Refet Gurkaynak show in their seminal 2010 paper, even the best DSGE models have very low forecasting power. Check out these tables from that paper:
















These tables show the forecasting performance for the Smets-Wouters model (which, remember, is the "best in class") from 1992 through 2006. The first table is for inflation forecasts, the second is for growth forecasts. Look at the R-squared values. These numbers loosely describe the amount of the actual macroeconomic aggregate (inflation or growth) that the model was able to predict. An R-squared of 1 would mean that the forecasts were perfect. You'll notice that most of the numbers are very, very low. The Smets-Wouters model was able to predict a bit of inflation one quarter out (though the Fed's internal forecasts were much better at that horizon), and not at all after one quarter. As for growth, the DSGE model had very low forecasting power even one quarter ahead.

Now, this doesn't necessarily mean that DSGE models are sub-optimal forecasters. These things might just be very very hard to predict! Humanity may simply not have any good tools (yet) for predicting macroeconomies, just like we aren't yet able to predict earthquakes.

But there's also some evidence that we could be doing better than we are. In this 2013 paper, Gurkaynak et al. test the "forecast efficiency" of DSGE models, and find that their forecasts are not optimal forecasts. Also, they find that simple univariate AR models are often significantly better at forecasting things like inflation and GDP growth than the best available DSGE models! This is not an encouraging finding for the DSGE paradigm, since AR models are just about the simplest thing you can use.

Also, in this discussion of forecasting, remember that the deck has already been stacked in favor of DSGE models. Why? Because of publicity bias and overfitting. If DSGE models don't do well at forecasting, researchers will add features until they do better. As soon as they do well enough to look good, researchers will publicize the success. This is a perfectly appropriate thing to do, of course - it's like improving any machine until it's good enough to sell. But it means that the publicized models will have a tendency to overfit the data, meaning that their out-of-sample performance will usually be worse than their in-sample and pseudo-out-of-sample performance.

(Update: Via a commenter, here's a good survey of DSGE models' forecasting ability, including how they did in the Great Recession. See my new post for more...)

In other words, DSGE models are probably not very good as forecasting tools...yet. But they're about as good as anything else we have. And they have improved considerably compared to their early incarnations.


2. Give policy advice?

This is what DSGE models are "supposed to do" - in other words, most academics will tell you that this is the purpose of the models. Actually, a model can be perfectly good for policy advice even if it's bad at forecasting. This is because forecasts have to deal with lots of different effects and noise and stuff that's all happening simultaneously, while policy advice only requires you to understand one phenomenon in isolation.

But here's the problem: To get good policy advice, you need to know which model to use, and when. So how do you choose between the various DSGE models? After all, there's a million and one of them out there. And they're usually mutually contradictory; since they're fitted using many of the same macroeconomic time-series (e.g. U.S. post-WW2 GDP, employment, and inflation), one of them being a good model (even just in one specific situation) means the others must then not be good models.

So how do you choose which model to use to give you advice? Old methods like "moment matching", which were used to "validate" the original RBC models, are, simply put, not very helpful at all.

What about hypothesis testing? Again, not very helpful. If you make the model itself the null, then of course you'll reject it, because any model will be too simplified to explain everything that's going on in the economy. If you make the null the hypothesis that the DSGE model parameters equal zero, you'll almost always reject that null, even if the model is grossly misspecified.

In principle, I think you should use some kind of goodness-of-fit criterion, like an R-squared, using out-of-sample data and adjusted to favor parsimonious models. At the macro conferences and seminars I've attended, I haven't see people saying "Look at the out-of-sample adjusted R-squared of this model! We should use this one for policy!" Maybe they do say this, though, and I just haven't seen it. (Update: Here, some people, including Smets and Wouters, do evaluate the fit! Definitely check out this paper if you're into macro modeling.)

But anyway, there's a few more problems here. One is the lack of clearly defined scope conditions; macro theorists rarely work on the difficult problem of when to stop using one model and start using another (see next section). Another is the nonlinearity problem; most DSGE models are linearized, which makes them easier (i.e. possible) to work with, but means that their policy recommendations often don't even match the model.

(As an aside, many people say "OK, we don't know which DSGE model is right, so just combine a bunch of models, with some weights." Fine...but the weights aren't structural parameters, so by doing this you give up the supposed "structural-ness" of DSGE models, which is the main reason people use DSGE models instead of a spreadsheet in the first place.)

So to sum up, DSGE models could offer policy advice if you used an appropriate model selection criterion, and dealt carefully with a bunch of other thorny issues, AND happened to find a model that seemed to fit the data decently well under some clearly defined set of observable conditions. But I don't think we seem to be there yet.


3. Map from DSGE models to policy advice?

OK, so it's really hard to give definitive policy advice with DSGE models. Maybe you could instead use DSGE models as maps from policymakers' assumptions to policy advice? I.e., you could say "Hey, policymaker, if you believe A and B and C, then here are the implications for policies X and Y and Z." In other words, since DSGE models are internally consistent, maybe they can help tell policymakers what they themselves think can be done with regards to the macroeconomy. (Another way of saying this is that maybe we can leave model selection up to the priors of the policymaker.)

There's just one problem with this. DSGE models are highly stylized, meaning that it's often not possible even to figure out whether you buy an assumption or not.

Let me demonstrate this. Let's take a look at a DSGE model - say, Christiano, Eichenbaum, and Evans (2005). This New Keynesian model is very similar to the Smets-Wouters model mentioned above. Here is a VERY truncated list of the assumptions necessary for this model to work:

  • Production consists of many intermediate goods, produced by monopolists, and one single consumption good" that is a CES combination of all the intermediate goods.
  • Firms who produce the consumption good make no profits.
  • Firms rent their capital in a perfectly competitive market.
  • Firms hire labor in a perfectly competitive market.
  • New firms cannot enter into, or exit from, markets.
  • All capital is owned by households, and firms act to maximize profits (no agency problems).
  • Firms can only change their prices at random times. These times are all independent of each other, and independent of anything about the firm, and independent of anything in the wider economy. (This is "Calvo pricing". The magic entity that allows some firms to change their prices is called the "Calvo Fairy").
  • The wage demanded by households is also subject to Calvo pricing (i.e. it can only be changed at random times).
  • Households purchase financial securities whose payoffs depend on whether the household is able to reoptimize its wage decision or not. Because they purchase these odd financial assets, all households have the same amount of of consumption and asset holdings.
  • Households derive utility from the change in their consumption, not from its level ("habit formation"). Households also don't like to work.
  • Households are rational, forward-looking, and utility-maximizing.

OK, I'll stop. Like I said, this is a VERY truncated list; the full list is maybe two or three times this long.

How many of these assumptions do you believe? I'm not sure that's even possible to answer. Formally, most of these are false. Some are very obviously false. The question is how good an approximation of reality they are. But how do we know that either?? Is it a good approximation of reality to say that households purchase financial securities whose payoffs depend on whether the household is able to reoptimize its wage decision or not? How would I even know? 

In principle, you could look at the micro evidence and see which of these assumptions looks kinda-sorta like real micro behavior. Some people have tried to do that with a few of the assumptions of the Smets-Wouters model; their results are not exactly encouraging. But if you tried to go ask a policymaker "Which of these things do you believe?", you'd get a blank stare.

So DSGE models don't make a clear map from assumptions to conclusions. But how about using them just to explore the robustness of models to variations in assumptions? A central bank (or the academic macro community) could make a bunch of DSGE models and compare their results, just to see how different modeling assumptions affect conclusions. In fact, that's probably what the academic macro community has been doing for the past 30 years. This seems somewhat useful to me, but there's a problem. DSGE models are not very tractable, so it's probably the case that nearly all of the modeling assumptions usable in DSGE models are poor approximations of reality. In that case, we'll be stuck searching next to the lamppost.


4. Communicate ideas?

DSGE models can definitely be used as a language in which to communicate ideas about how the economy works. But they are probably not the best such language. Simpler econ models, like OLG models, or even partial-equilibrium models, are much more flexible, and can be understood much more quickly by an interlocutor. DSGE models have a ton of moving parts, and it's generally very hard to see which assumptions end up causing which results. The better a model matches data or forecasts future data, the more moving parts it will generally have. This is called the "realism-tractability tradeoff". 

So if you only work with DSGE models, and if you try to understand everything in terms of DSGE models, you'll have a hard time communicating with other economists. I can see this being a problem in a central bank, where people need to communicate ideas very quickly in times of crisis.


So, what else would you have us do?

There are a number of alternatives that have been proposed to DSGE models. Different alternatives are generally proposed for the different purposes listed above.

For communicating ideas, the most popular alternatives are simpler, OLG-type models (which are, technically, DSGE, though not what we typically call "DSGE"!), and partial-equilibrium models (suggested by Robert Solow). I've seen some people use these at seminars, especially the OLG type, so I think this alternative may be catching on.

For forecasting, the common alternatives are "spreadsheet" type models (Chris Sims' dismissive term) that don't assume structural-ness. This is the kind of model used by the Fed (the FRB/US) and by some private forecasting firms like Macroadvisers.

Policy advice is the thorniest question, since you need your model to be structural. For this, the main alternative that has been put forth is called "agent-based modeling". I don't know too much about this, and the name is weird, because DSGE models are also agent-based. But basically what it seems to mean is to specify a set of microfoundations (behavioral rules for agents), and then do a big simulation. The big difference between this and DSGE is that with DSGE you can write down a set of equations that supposedly govern the macroeconomy, and with ABM you can't.


So are we wasting our time making all these DSGE models, or not?

My answer is: I'm not sure. So far, we don't seem to have gotten a heck of a lot of a return from the massive amount of intellectual capital that we have invested in making, exploring, and applying these models. In principle, though, there's no reason why they can't be useful. They have flaws, but not any clear "fatal flaw". They're not the only game in town, and realization of that fact seems to be slowly spreading, though cultural momentum may mean that the more recently invented alternatives (ABM) will take decades to catch up in popularity, if they ever do.
reade more... Résuméabuiyad